About: Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells

Facets (new session)
Description
Metadata
Settings
- owl:sameAs
- Inference Rule:

About: Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells Goto Sponge NotDistinct Permalink

An Entity of Type : schema:ScholarlyArticle, within Data Space : wasabi.inria.fr associated with source document(s)

Attributes	Values
type	Academic Article research paper schema:ScholarlyArticle
isDefinedBy	Covid-on-the-Web dataset
has title	Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells
Creator	Fossum, Caroline Domeika, Kristina Eloranta, Maija-Leena Fuxler, Lisbeth Magnusson, Mattias Alm, Gunnar
Source	Elsevier; Medline; PMC
abstract	Abstract The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-α (IFN-α) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-α/β producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-α production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5′ TTTTCAATTCGAAGATGAAT 3′ (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-α. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-α induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-α without pre-incubation with lipofectin, for instance the ODN 2216 (5′ GGGGGACGATCGTCGGGGGG 3′). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-α levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-α. The identity of the IFN-α producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-α and surface markers. Approximately 1–3 IPC/103 PBMC were detected, compared to only 3 IPC/104 PBMC stimulated by Aujeszky’s disease virus. The IPC frequencies were confirmed by detection of IFN-α mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.
has issue date	2004-09-30(xsd:dateTime)
bibo:doi	10.1016/j.vetimm.2004.04.017
bibo:pmid	15261695
has license	els-covid
sha1sum (hex)	0ed06e6ddd6b107ca9a79aafe02388132873abe8
schema:url	https://doi.org/10.1016/j.vetimm.2004.04.017
resource representing a document's title	Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-α in the pig and the phenotype of the IFN-α producing cells
has PubMed Central identifier	PMC7125693
has PubMed identifier	15261695
schema:publication	Veterinary Immunology and Immunopathology
resource representing a document's body	covid:0ed06e6ddd6b107ca9a79aafe02388132873abe8#body_text
is schema:about of	named entity 'CHARACTERISTICS' named entity 'CELLS MONOCYTES' named entity 'MHC class II' named entity 'IFN-a' named entity 'lipofection' named entity 'levels' named entity 'production' named entity 'sequences' named entity 'The' named entity 'trigger' named entity 'situ' named entity 'CpG' named entity 'stimulated' named entity 'CD21' named entity 'phenotype' named entity 'DETECTED' named entity 'B CELLS' named entity 'PHOSPHOROTHIOATE' named entity 'STAINING' named entity 'APPROXIMATELY' named entity 'IDENTITY' named entity 'PRESENT' named entity 'INDUCED' named entity 'MYELOID' named entity 'INDUCTION' named entity 'METHYLATION' named entity 'FREQUENCIES' named entity 'UP TO' named entity 'DENDRITIC CELLS' named entity 'VARIATION' named entity 'AMOUNTS' named entity 'CONTEXTS' named entity 'PHENOTYPE' covid:arg/0ed06e6ddd6b107ca9a79aafe02388132873abe8 named entity '27S' named entity 'FORMS' named entity 'OLIGODEOXYRIBONUCLEOTIDES' named entity 'MARKERS' named entity 'SWC3' named entity 'MHC CLASS II' named entity 'HAVE' named entity 'ACTIVATED' named entity 'FLOW CYTOMETRY' named entity 'CPG-ODN' named entity 'CD4' named entity 'CD21' named entity 'PHENOTYPE' named entity 'IFN-A' named entity 'INDUCE' named entity 'INTERFERON ' named entity 'OLIGODEOXYRIBONUCLEOTIDES' named entity 'PRODUCING' named entity 'CD14' named entity 'PIG' named entity 'MARKER' named entity 'INCREASES' named entity 'ADDED' named entity 'REFERRED TO' named entity 'CERTAIN' named entity 'LIPOFECTIN' named entity 'VARIOUS' named entity 'SUBSTITUTION' named entity 'TO INCREASE' named entity 'IFN-A' named entity '2F10' named entity 'DOUBLE' named entity 'UPTAKE' named entity 'SEQUENCES' named entity 'RESPONSE TO' named entity 'SIMILAR' named entity 'LEVELS' named entity 'IN SITU HYBRIDISATION' named entity 'POSITIVE' named entity 'MAJOR' named entity 'DINUCLEOTIDES' named entity 'IPC'

Faceted Search & Find service v1.13.91 as of Mar 24 2020

Alternative Linked Data Documents: Sponger | ODE Content Formats:

RDF

ODATA

Microdata

About

OpenLink Virtuoso version 07.20.3229 as of Jul 10 2020, on Linux (x86_64-pc-linux-gnu), Single-Server Edition (94 GB total memory)
Data on this page belongs to its respective rights holders.
Virtuoso Faceted Browser Copyright © 2009-2024 OpenLink Software