About: Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus

Facets (new session)
Description
Metadata
Settings
- owl:sameAs
- Inference Rule:

About: Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus Goto Sponge NotDistinct Permalink

An Entity of Type : schema:ScholarlyArticle, within Data Space : wasabi.inria.fr associated with source document(s)

Attributes	Values
type	Academic Article research paper schema:ScholarlyArticle
isDefinedBy	Covid-on-the-Web dataset
has title	Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus
Creator	Ruan, Jishou Liu, Chang Chen, Ze Hu, Yue Bu, Wenjun Gao, Shan Ji, Haishuo Li, Siyu Shen, Wenyuan Yu, Deshui Id, †
Source	Medline; PMC
abstract	In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.
has issue date	2018-09-05(xsd:dateTime)
bibo:doi	10.3390/genes9090442
bibo:pmid	30189613
has license	cc-by
sha1sum (hex)	f9426bdcd204747d493857d5a88efaf70c2cbee5
schema:url	https://doi.org/10.3390/genes9090442
resource representing a document's title	Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus
has PubMed Central identifier	PMC6162610
has PubMed identifier	30189613
schema:publication	Genes (Basel)
resource representing a document's body	covid:f9426bdcd204747d493857d5a88efaf70c2cbee5#body_text
is schema:about of	named entity 'apoptosis' named entity 'complemented' named entity 'pathogenesis' named entity 'small RNAs' named entity 'Researchers' named entity 'SARS Coronavirus' covid:arg/f9426bdcd204747d493857d5a88efaf70c2cbee5 named entity 'segment' named entity 'molecular' named entity 'infection' named entity 'cell' named entity 'DNA' named entity 'phylogenetic analysis' named entity 'pathogen' named entity 'lengths' named entity 'small RNAs' named entity 'RNA interference' named entity 'betacoronavirus' named entity 'phylogeny' named entity 'small RNAs' named entity 'cpsR' named entity 'pathogenesis' named entity 'cpsR' named entity 'small RNAs' named entity 'infection' named entity 'viral genomes' named entity 'viruses' named entity 'SARS-CoV' named entity 'phylogenetic analysis' named entity 'infection' named entity 'SARS-CoV' named entity 'RNA' named entity 'animal virus' named entity 'nucleic acid sequence' named entity 'siRNA' named entity 'betacoronavirus' named entity 'transfection' named entity 'betacoronaviruses' named entity 'sRNA' named entity 'palindrome' named entity 'Mountain View, CA' named entity 'pathogenesis' named entity 'DNA motifs' named entity 'insertions/deletions' named entity 'transcription' named entity 'invertebrate' named entity 'SARS' named entity 'EBV' named entity 'TaKaRa Bio' named entity 'database' named entity 'equines' named entity 'betacoronavirus' named entity 'invertebrate' named entity 'mice' named entity 'RNAi' named entity 'duplexes' named entity 'FITC' named entity 'complementary DNA' named entity 'melting temperature' named entity 'duplexes' named entity 'Bowtie' named entity 'library preparation' named entity 'duplexes' named entity 'gene' named entity 'mammals' named entity 'coronavirus' named entity 'genome sequences' named entity 'apoptosis' named entity 'cell apoptosis' named entity 'species barrier' named entity 'staining'

Faceted Search & Find service v1.13.91 as of Mar 24 2020

Alternative Linked Data Documents: Sponger | ODE Content Formats:

RDF

ODATA

Microdata

About

OpenLink Virtuoso version 07.20.3229 as of Jul 10 2020, on Linux (x86_64-pc-linux-gnu), Single-Server Edition (94 GB total memory)
Data on this page belongs to its respective rights holders.
Virtuoso Faceted Browser Copyright © 2009-2024 OpenLink Software